2.1 DNA and protein sequence alignment based on segment-to-segment comparison alignment:multiple Morgenstern, Dress, Werner B. Morgenstern (1999). DIALIGN 2: improvement of the segment-to-segment approach to multiple sequence alignment. Bioinformatics 15, 211 - 218. dialign2 dialign2 seqlab dialign2 perl "dialign2" 0 sequence Sequences perl " $value" 100 Give here the sequences you want to align (you can give more than 2 sequences). The FASTA format is accepted - example: >name1 TACTTTACCCAGTAGTCATGTACAGAGT ACCGCCTCAATAAAAAGCCTAAGAGTCA >name2 CCCATATGTGTAGAAGTTGCCTCGAGTG TTTACGCGGGGGCGGGCATTCTTTAAAC CACGCGGGGGATATTGCGAAACACCCAT GAGAGAGGGGGGAATGCCCCGTA >name3 ACCTACTCTCCCCCCCCTTTTCCCAACT ATCTAATCTATTTYCAGGGCGTGGACGG GGGGG 1 8 4 seqsfile perl 1 protein_dna Nucleic acid or protein alignment perl ($value eq "n")? " -n" : "" p 3 p p: protein n n: nucleic dialign_opt Others options 7 threshold Threshold perl (defined $value && $value != $vdef)? " -thr $value" : "" 0.0 7 translation Translation of nucleotide diagonals into peptide diagonals (DNA) perl ($protein_dna eq "n" && $value)? "t" : "" 0 4 max_simil Maximum number of * characters representing degree similarity perl ($value && $value != $vdef)? " -stars $value" : "" 5 7 The number of `*' characters below the alignment reflects the degree of local similarity among sequences. More precisely: They represent the sum of `weights' of diagonals connecting residues at the respective position. The number of `*' characters is normalized such that regions of maximum similarity have N `*' characters per column. N can be specified by the user. By default, N = 5. Note that the number of `*' characters depicts therelative degree of similarity within an alignment, since in every alignment, the region of maximum similarity gets N `*' characters. output_options Output options 7 fasta Alignment in fasta format perl ($value)? " -fa" : "" 0 7 Be aware that only upper-case letters are regarded to be aligned in fasta output file. ali *.ali *.fa